Humans:1 Genome:0
May 17, 2006 7:45 PM Subscribe
The final chromosome in the human genome has been sequenced. The Human Genome Project has completed sequencing Chromosome 1 and has published its work in Nature here. If you're impatient, here's a sneak preview..
I thought they finished this a couple years ago...
If they weren't finished, what were they hollering about then, anyway?
posted by beth at 7:55 PM on May 17, 2006
If they weren't finished, what were they hollering about then, anyway?
posted by beth at 7:55 PM on May 17, 2006
Old and busted - Human Genome Project
The New Hotness - The Human Proteome Project
posted by isopraxis at 7:58 PM on May 17, 2006
The New Hotness - The Human Proteome Project
posted by isopraxis at 7:58 PM on May 17, 2006
dood... isopraxis. good call.
posted by Parannoyed at 8:05 PM on May 17, 2006
posted by Parannoyed at 8:05 PM on May 17, 2006
Very. Good. Call.
Protien folding is the way of the future. Eventually understanding misfolded protiens could help cure Alzheimer's- and any number of devastating diseases.
You can also check out this distributed computing client through Stanford University. Get into the spirit- join a DC team and watch those protiens fold!
Seriously, what else do you do with that 3ghz processor?
Not a shill. Help fold protiens so we can cure this stuff before I get old!
posted by T.D. Strange at 8:28 PM on May 17, 2006
Protien folding is the way of the future. Eventually understanding misfolded protiens could help cure Alzheimer's- and any number of devastating diseases.
You can also check out this distributed computing client through Stanford University. Get into the spirit- join a DC team and watch those protiens fold!
Seriously, what else do you do with that 3ghz processor?
Not a shill. Help fold protiens so we can cure this stuff before I get old!
posted by T.D. Strange at 8:28 PM on May 17, 2006
This is all fine and good, but until it delivers a dozen Epsilon Semi-Morons to my doorstep to serve my beck and call and fuel my undeserved life of luxury it means bupkis.
posted by loquacious at 8:33 PM on May 17, 2006
posted by loquacious at 8:33 PM on May 17, 2006
until it delivers a dozen Epsilon Semi-Morons to my doorstep to serve my beck and call and fuel my undeserved life of luxury it means bupkis.
Wait, you think fratboys will actually do work?
posted by trondant at 8:36 PM on May 17, 2006
Wait, you think fratboys will actually do work?
posted by trondant at 8:36 PM on May 17, 2006
I suppose I get plus one talent per base now, don't I?
posted by Lord Chancellor at 8:59 PM on May 17, 2006
posted by Lord Chancellor at 8:59 PM on May 17, 2006
Protien folding is the way of the future. Eventually understanding misfolded protiens could help cure Alzheimer's- and any number of devastating diseases.
Way to think small. Understanding protein folding in total would go a long way to understanding every single reaction in the human body.
posted by delmoi at 9:05 PM on May 17, 2006
Way to think small. Understanding protein folding in total would go a long way to understanding every single reaction in the human body.
posted by delmoi at 9:05 PM on May 17, 2006
Wait, you think fratboys will actually do work?
Touche'. Well, no, I suppose not. But that gaggle of 96 identical sorority sisters is lookin' awfully pneumatic. Look out, Malthus, here I come!
posted by loquacious at 9:06 PM on May 17, 2006
Touche'. Well, no, I suppose not. But that gaggle of 96 identical sorority sisters is lookin' awfully pneumatic. Look out, Malthus, here I come!
posted by loquacious at 9:06 PM on May 17, 2006
In other news, Neanderthal yields nuclear DNA, Chimpanzee and human ancestors may have interbred.
posted by MetaMonkey at 9:14 PM on May 17, 2006
posted by MetaMonkey at 9:14 PM on May 17, 2006
Still not really finished - from the Nature paper:
There are 18 megabases (Mb) of heterochromatin* on 1q adjacent to the centromere that has not been sequenced.
This partially answers Beth's question: the hoo-ha six years ago or whenever it was was to celebrate an arbitrary "nearly done" target of about 96% of the euchromatin* portion of the genome. This much was enough to perform a lot of genuinely useful analysis.
For the remaining 4% or so there is a law of diminishing returns; for one reason or another each bit wasn't sequenced the first time around, probably because it was difficult to isolate (most likely because bacteria don't like to make copies of it for us) and so a lot of effort needed to be expended for each little bit. No need to hold up all the fame and glory for those little bits, which will take years to do, when the achievement of doing 94% in 15 months deserved recognition.
*euchromatin is the part of the DNA where most of the genes are; it is relatively easy to work with. By contrast, hetechromatin is very difficult to manipulate and sequence, because it has lots of repeated sequences that cause all manner of technical problems. Heterochromatin contains fewer genes than euchromatin, and so many regard it as less interesting.
posted by nowonmai at 9:28 PM on May 17, 2006
There are 18 megabases (Mb) of heterochromatin* on 1q adjacent to the centromere that has not been sequenced.
This partially answers Beth's question: the hoo-ha six years ago or whenever it was was to celebrate an arbitrary "nearly done" target of about 96% of the euchromatin* portion of the genome. This much was enough to perform a lot of genuinely useful analysis.
For the remaining 4% or so there is a law of diminishing returns; for one reason or another each bit wasn't sequenced the first time around, probably because it was difficult to isolate (most likely because bacteria don't like to make copies of it for us) and so a lot of effort needed to be expended for each little bit. No need to hold up all the fame and glory for those little bits, which will take years to do, when the achievement of doing 94% in 15 months deserved recognition.
*euchromatin is the part of the DNA where most of the genes are; it is relatively easy to work with. By contrast, hetechromatin is very difficult to manipulate and sequence, because it has lots of repeated sequences that cause all manner of technical problems. Heterochromatin contains fewer genes than euchromatin, and so many regard it as less interesting.
posted by nowonmai at 9:28 PM on May 17, 2006
delmoi said: Way to think small. Understanding protein folding in total would go a long way to understanding every single reaction in the human body.
Way to think small. You forgot RNA and its folding.
posted by gsb at 10:05 PM on May 17, 2006
Way to think small. You forgot RNA and its folding.
posted by gsb at 10:05 PM on May 17, 2006
Ha, I totally screwed up on my prediction on the 143rd line sequence. I put $50 on GAGT. Oh well, I guess it's back to my monkey salamander hybrids for me.
posted by blue_beetle at 10:10 PM on May 17, 2006
posted by blue_beetle at 10:10 PM on May 17, 2006
This is pretty awesome, but I'm... underwhelmed. So we know the sequence of all of the genes and we can still... die of Alzheimers? Great.
posted by grapefruitmoon at 10:28 PM on May 17, 2006
posted by grapefruitmoon at 10:28 PM on May 17, 2006
Way to think small. You forgot RNA and its folding.
Oops, you're right.
posted by delmoi at 10:30 PM on May 17, 2006
Oops, you're right.
posted by delmoi at 10:30 PM on May 17, 2006
It's more than just sequencing. The team completed a full annotation of the gene map on chromosome 1 - that's the significant, time-consuming element. Sequencing is like reading a book without thinking. Annotation is taking dense, detailed notes about what you're reading.
posted by junesix at 10:45 PM on May 17, 2006
posted by junesix at 10:45 PM on May 17, 2006
grapefruitmoon: One step at a time. Sequencing and annotation were never going to solve the world's diseases. But at least scientists now have a better idea of what they're working with. The point is to continually build the base of knowledge to identify possible targets for solutions. Like the old PSA's, "The More You Know..."
posted by junesix at 11:03 PM on May 17, 2006
posted by junesix at 11:03 PM on May 17, 2006
This project always kinda despressed me. It's one thing to have one sequence of base pairs. And even better to be able to allocate and annotate that into genes. Everyone's alleles are different, and that's where the interesting stuff lies - once we've got a map of allelic variation then I'll feel like we've made some progress.
posted by Jimbob at 11:21 PM on May 17, 2006
posted by Jimbob at 11:21 PM on May 17, 2006
Misfolded protiens are spelling mistakes with consequences.
posted by weapons-grade pandemonium at 11:29 PM on May 17, 2006
posted by weapons-grade pandemonium at 11:29 PM on May 17, 2006
Yeah, junesix, I should have been more precise, the sequencing was done in like 2003, like you said, this is the more complicated parsing of the chromosome into meaningful genes and such.
I'm all for the proteome, too, but that's a whole other beast. And anyway, it's good that we have the genome so we have the ground floor for protein synthesis there. It'd be ghetto to say, "OK, so this is a recurring fold problem... let's look at the original sequence and nearby SNPs that may have messed it up... oh wait, we don't have that yet! Son of a" and so on. I'm pretty ignorant and out of the loop when it comes to molecular bio but it's still a milestone and I thought I'd put it out there.
Is it a little insane, though, that Project Gutenberg has the whole thing, though? Isn't that.... a little bit sci-fi?
posted by BlackLeotardFront at 12:25 AM on May 18, 2006
I'm all for the proteome, too, but that's a whole other beast. And anyway, it's good that we have the genome so we have the ground floor for protein synthesis there. It'd be ghetto to say, "OK, so this is a recurring fold problem... let's look at the original sequence and nearby SNPs that may have messed it up... oh wait, we don't have that yet! Son of a" and so on. I'm pretty ignorant and out of the loop when it comes to molecular bio but it's still a milestone and I thought I'd put it out there.
Is it a little insane, though, that Project Gutenberg has the whole thing, though? Isn't that.... a little bit sci-fi?
posted by BlackLeotardFront at 12:25 AM on May 18, 2006
GATTACA appears three times in the first thousand lines of Chromosome 1.
The more you know....
posted by quite unimportant at 12:27 AM on May 18, 2006
The more you know....
posted by quite unimportant at 12:27 AM on May 18, 2006
SPOILER ALERT
TGCCTTCCCCATGTATCTGTAA GGGTATTTTCCTATAACTGAGT
ATTAAATG
posted by TwelveTwo at 12:55 AM on May 18, 2006
TGCCTTCCCCATGTATCTGTAA GGGTATTTTCCTATAACTGAGT
ATTAAATG
posted by TwelveTwo at 12:55 AM on May 18, 2006
What's that TwelveTwo? You say Jesus got with Mary Magdelene? No way!
posted by Jimbob at 1:36 AM on May 18, 2006
posted by Jimbob at 1:36 AM on May 18, 2006
"ACCAACACCACTGCCATCGTCATCACCACCACTGTCA
TTATCACCACCACCATCACCAACATCACCACCACCAT"
I knew it!!!
posted by lemonfridge at 1:47 AM on May 18, 2006
TTATCACCACCACCATCACCAACATCACCACCACCAT"
I knew it!!!
posted by lemonfridge at 1:47 AM on May 18, 2006
Is it a little insane, though, that Project Gutenberg has the whole thing, though?
They have an old version, though. The newest version of the human assembly was released in March 2006. Someone must not have explained to the Project Gutenburg people that the reference sequence was going to keep changing.
posted by grouse at 2:21 AM on May 18, 2006
They have an old version, though. The newest version of the human assembly was released in March 2006. Someone must not have explained to the Project Gutenburg people that the reference sequence was going to keep changing.
posted by grouse at 2:21 AM on May 18, 2006
The Doom movie lied!
posted by slimepuppy at 2:52 AM on May 18, 2006
posted by slimepuppy at 2:52 AM on May 18, 2006
Just because I think it's a wonderful web app, here's a link to chromosome 1 in the ensembl genome broswer.
posted by primer_dimer at 7:28 AM on May 18, 2006
posted by primer_dimer at 7:28 AM on May 18, 2006
Of somewhat related interest: The Human Genome Diversity Project
posted by carmen at 7:47 AM on May 18, 2006
posted by carmen at 7:47 AM on May 18, 2006
« Older Warnings | Comic books and bondage. Two great tastes that... Newer »
This thread has been archived and is closed to new comments
And this is an out-of-date, but interesting way of checking out the chromosomes. Couldn't find the new version, which (if it's really Genome map '99) is just as out of date.
posted by BlackLeotardFront at 7:50 PM on May 17, 2006