"You're all clear, kid. Now let's blow this thing & finally leave home!"

February 15, 2021 5:37 PM

Explaining how mRNA vaccines work using Star Wars. (There really is an xkcd for everything.)
posted by metabaroque (27 comments total)

I had no idea the little people had names.
posted by Joe in Australia at 5:48 PM on February 15, 2021 [3 favorites]

Surely you remember Little Bobby Tables.
posted by ChurchHatesTucker at 6:39 PM on February 15, 2021 [6 favorites]

If Katalin Karikó doesn't get the Nobel prize then once I'm vaccinated I'm going to fly to Sweden and stand outside the Nobel search committee with a boombox playing "In Your Eyes" until they relent.

mRNA vaccines are a god damned miracle. Not just for COVID. A lot of the vaccines we have now are limited in both how effective and how fast we can make them. To make a conventional flu vaccine you basically need millions upon millions of fertilized chicken eggs. During that process the virus that's injected into the chicken eggs can also mutate into other forms that may not be as effective. Plus, since you need to grow the virus, it takes half the year to do it and if you predict incorrectly the flu vaccine could be near useless.

An mRNA vaccine on the other hand is relatively precise. What researchers spit out from the mRNA magic box is what will be injected into the person receiving the vaccine. Select for a specific hemagglutinin? They can do that. Want to change which hemagglutinin to target on a dime? They can do that too. Want to include a few of them? Why not!

This is where the power lies for these things and public health. We can churn out mRNA vaccines at a frankly astounding rate and we can make them far more effective. Way less people will have to die during flu seasons going forward once this tech gets kicked into common vaccine gear. They're even talking about trying out sequences to find efficacy for all respiratory virus families. No more colds!

mRNA vaccines are a god damned miracle of modern science.
posted by Your Childhood Pet Rock at 7:18 PM on February 15, 2021 [64 favorites]

that and masks.
posted by wmo at 7:21 PM on February 15, 2021 [6 favorites]

Since I don't have a background in science, I wonder about something. I know that it's easier to combat bacteria than it is to combat viruses, hence why treatments for viral infections tend to be about symptom relief. But does the development of mRNA vaccines mean potential treatment for sexually transmitted viral diseases as well, like HIV and herpes?

Basically, I'm just asking, what does this mean in terms of combatting viruses in general? Is it just better/cheaper vaccines or does it also mean potential cures for those who've acquired those viruses?
posted by NotTheRedBaron at 7:47 PM on February 15, 2021 [1 favorite]

This was extremely helpful. Thanks for posting it.
posted by rednikki at 7:54 PM on February 15, 2021

NotTheRedBaron I can't answer your question though I do work in a scientific field. Off the top of my head different viruses can be very different in how they replicate, how they get into the cell, and what their deployment package is (ie rna, DNA, etc). I know there are a bunch of super passionate brilliant people working in STIs, and if there's any chance to take what we've learned from coronaviruses and apply it to STIs, I'm very hopeful that they'll figure out how to do it.

Good folks work in that field - no one does the work because it's fun at dinner parties, but because we all know someone whose life has changed irrevocably because of them. So I can't answer your specific question, but I'm hopeful that the right folks are working on it.
posted by esoteric things at 8:31 PM on February 15, 2021 [1 favorite]

Another explainer
posted by azpenguin at 9:00 PM on February 15, 2021 [2 favorites]

In human/virus terms, why is the practice death star not firing at the planet?
posted by aniola at 11:08 PM on February 15, 2021

In human/virus terms, why is the practice death star not firing at the planet?

Princess Leia did not actually include the correct drawings for the laser in the blueprints she provided. It doesn't work.
posted by brambleboy at 11:14 PM on February 15, 2021 [9 favorites]

mRNA vaccines are a god damned miracle of modern science.

I hope people keep thoughts like this in mind when they express pessimism about how the world is handling the pandemic. Because it's not just vaccine technology, it's also the internet and the ability to transfer whole sections of the economy and society online. None of this would have been possible even ten years ago.

It's easy to focus on vaccine nationalism and anti-mask protests as demonstrating our social failures, but how well were we expecting this to go? This is not a rhetorical question. The worst case scenario is everyone waiting for herd immunity and the collapse of all international cooperation. That's not what I'm seeing. I'm seeing how, under enormous pressure, people are mostly complying, lockdowns are mostly working, and countries are mostly distributing vaccines and trying to solve a global problem.

This is a once-in-a-century pandemic. Any other time in human history, such an event would have toppled civilizations around the world. For us, it's very hard, and there's a lot of suffering, but we're getting through it. This is a feat of modern civilization, and it's pretty remarkable.
posted by Alex404 at 12:45 AM on February 16, 2021 [22 favorites]

In human/virus terms, why is the practice death star not firing at the planet?

Princess Leia provided the construction crew with plans for the part with the thermal exhaust port only but it would look silly in a comic if people freaked out because of some bit of an orbital station.
posted by hat_eater at 1:46 AM on February 16, 2021 [4 favorites]

It's great, but I do feel sorry for the guy on the bridge of the non-functional Death Star...
posted by TheophileEscargot at 2:21 AM on February 16, 2021 [8 favorites]

In human/virus terms, why is the practice death star not firing at the planet?

Not a doc, not an epidemiologist, but I think it's because the mRNA vaccine doesn't contain the live virus, just the outer appearance of it (spike proteins). So in the comic, the practice death star was built to have the outer shell of the real one, but nothing inside that could hurt the Rebels.
posted by kimberussell at 5:38 AM on February 16, 2021 [5 favorites]

Not a doc, not an epidemiologist, but I think it's because the mRNA vaccine doesn't contain the live virus, just the outer appearance of it (spike proteins). So in the comic, the practice death star was built to have the outer shell of the real one, but nothing inside that could hurt the Rebels.

That's my understanding as well. The little guy inside the first "Death Star" says the laser isn't connected, which I think is supposed to imply that concept.
posted by Gelatin at 6:10 AM on February 16, 2021 [5 favorites]

This is a once-in-a-century pandemic. Any other time in human history, such an event would have toppled civilizations around the world. For us, it's very hard, and there's a lot of suffering, but we're getting through it. This is a feat of modern civilization, and it's pretty remarkable.

Thank you. For the past couple months I've been feeling like the world didn't have enough pasta after all, but when you put things that way, I feel slightly better and a little more optimistic.
posted by RonButNotStupid at 6:21 AM on February 16, 2021 [8 favorites]

There was plenty of pasta but the "brains" things turned out to not really work.
posted by TheophileEscargot at 6:34 AM on February 16, 2021 [2 favorites]

I can't get past the retcon of Princess Leia being the one who designed the Death Star which later (and now can't have) destroyed Alderaan. Maybe this is why I'm still so bad at understanding science.
posted by Mchelly at 7:06 AM on February 16, 2021 [1 favorite]

I don't think that's a retcon. I imagine this takes place after Leia arrives on Yavin 4. Maybe there should have been a bit about the plans being retrieved from R2?
posted by RonButNotStupid at 7:19 AM on February 16, 2021 [2 favorites]

I don't think that's a retcon. I imagine this takes place after Leia arrives on Yavin 4. Maybe there should have been a bit about the plans being retrieved from R2?

It's as if the Death Star didn't have hyperdrive, so by the time it shows up at Yavin, the rebels have had an opportunity to construct a replica to practice their attack runs.
posted by Gelatin at 7:28 AM on February 16, 2021 [3 favorites]

Then your body gets super good at going "AAAAAAH AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAG: when it sees spikes
posted by little onion at 8:02 AM on February 16, 2021 [5 favorites]

In human/virus terms, why is the practice death star not firing at the planet?

Because the plans are not actually for a Death Star, just for the greebling on the outside.

Unlike the canonical Death Star, the ones the Empire has in this analogy don't destroy planets by firing a huge ray gun from a distance. Instead, they work by extending tentacular delivery tubes down through the atmosphere, through which they distribute brochures for a multi-level marketing scheme so overwhelmingly enticing that everybody on the planet becomes obsessed with making a fortune selling replica Death Stars on commission.

Every factory on the planet immediately starts churning them out from the plans included with the brochure, and in just a few days every garage, home, office, church, school and hospital is stuffed so chock-a-block with unsaleable product that nothing works any more and the entire economy just implodes.
posted by flabdablet at 8:11 AM on February 16, 2021 [12 favorites]

I don't think that's a retcon. I imagine this takes place after Leia arrives on Yavin 4. Maybe there should have been a bit about the plans being retrieved from R2?

At the risk of both derail and outing myself as blindingly stupid...didn't Leia have the Death Star plans because Jyn Erso learned of her father's deliberate design flaw and got the schematics to Leia?
posted by cooker girl at 10:02 AM on February 16, 2021 [1 favorite]

Someone upthread mentioned that they get a little jazzed at people understanding the science. I do too...
I was reading the comments in a podcast that were a bit cynical re: covid is a hoax because there's no flu going around and you can't claim it's because of washing hands, distancing, etc... because covid is (allegedly) out of control. There was some discussion around R-nought, etc... but someone brought up this video about viral interference.

At the end, this doctor discusses potentially using a similar mRNA idea with a viral interference strategy to basically stall a pandemic while the 'real' working mRNA vaccine is being identified and developed. I thought that was pretty cool.

(it would be like putting an incomplete deathstar in front of a real deathstar and attacking that first. Since the 'real' deathstar can't focus its laser on the planet, you get to buy yourself some time)
posted by kookywon at 12:00 PM on February 16, 2021 [2 favorites]

There was some discussion around R-nought, etc... but someone brought up this video about viral interference.

Kind of makes sense. Think of all the effects your body goes under as it's fighting a respiratory infection. Runny nose? That's your body overproducing mucus to block your nose going to the rest of your respiratory tract. Cough? That's your body ejecting excess mucus from the lining of your central airway. The mucus, being a fairly sticky thing traps the virions and works to make if less likely that virions get to the epithelial cells that line our airways. Now the body is producing piles of it in order to trap as many virions as possible. If you're already fighting one virus, the other is going to have a hard time getting past these hyperactive first line defenses, little alone competing for cells to use as a host.

He talks about interferon. What does interferon do? It's literally an inflammatory signaler. Like a beacon to show where to bring the innate immune system's effector cells to bear. Those cells start eating all the virions they can find and whether they're rhinovirus or flu they don't care. It sees pathogen, it eats pathogen. If the body is in the middle of an immune response what's going to be around in large numbers? So you've also got a hyperactive second line of defense to get through now as well.

So yeah, not surprising that there's viral interference.
posted by Your Childhood Pet Rock at 3:38 PM on February 16, 2021 [2 favorites]

Okay, I guess this is good as far as it goes, but it in no way explains how the 5G signal pings off the nanochips in the vaccine to upload your genetic information to Bill Gates’s cloud database.
posted by Naberius at 8:36 PM on February 16, 2021 [1 favorite]

"Okay, I guess this is good as far as it goes, but it in no way explains how the 5G signal pings off the nanochips in the vaccine to upload your genetic information to Bill Gates’s cloud database."

That gets answered in Rogue One.
posted by NotTheRedBaron at 9:22 PM on February 16, 2021 [6 favorites]